logo
Volume 28, Issue 4 (Autumn 2022)                   Intern Med Today 2022, 28(4): 464-477 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Vakilpour M, Khazaei-Koohpar Z. First Report of Variable Number of Tandem Repeat Alleles in Phenylalanine Hydroxylase Gene in Patients With Phenylketonuria From Guilan Province, Iran. Intern Med Today 2022; 28 (4) :464-477
URL: http://imtj.gmu.ac.ir/article-1-3917-en.html
1- Department of Genetics, Faculty of Biological Sciences, Tonekabon Branch, Islamic Azad University, Tonekabon, Iran.
2- Department of Cellular and Molecular Biology, Faculty of Biological Sciences, Tonekabon Branch, Islamic Azad University, Tonekabon, Iran. , ze.khazaei@iau.ac.ir
Full-Text [PDF 4802 kb]   (1130 Downloads)     |   Abstract (HTML)  (2986 Views)
Full-Text:   (1581 Views)
Introduction
Phenylketonuria (PKU) and hyperphenylalaninemia (HPA) are the result of the deficiency of hepatic phenylalanine hydroxylase (PAH). PAH deficiency leads to an abnormal increase in serum phenylalanine (Phe), that is, more than 120 µmol/L, which leads to irreversible mental retardation in untreated patients [1]. PKU is an autosomal recessive disease and the most common disorder of amino acid metabolism with a wide range of clinical and biochemical manifestations, comprising different geographical prevalences [2]. The prevalence of PKU in Caucasians is 1 in 10000 births; however, it is significantly higher in the East Mediterranean region. The highest prevalence of PKU has been reported in this region of the world, 1 in 4000 in Turkey and 1 in 3627 in Iran. This high prevalence can be considered primarily due to the high rate of family marriage in the region [3]. In another study, the highest prevalence was reported in Turkey and the lowest prevalence was reported in the UAE [4]. Hyperphenylalaninemia is the result of any increase in the level of phenylalanine in the blood. This level in healthy children is less than 120 µmol/L [5]. In mild hyperphenylalaninemia (MHP), this number is 120 to 600 μmol/L, in mild PKU (mPKU) it is 600 to 1200 μmol/L, and in classic PKU (cPKU) it is more than 1200 μmol/L [6]. The PAH gene with a length of 90 kilobases is located on chromosome 12 in the q22-q24.1 region, which includes 13 exons and 12 introns [7]. PAH protein has a tetrameric structure with several subunits, each of which consists of 3 domains, namely a regulatory domain at the N terminal, a catalytic domain, and a tetramerization domain at the C terminal [7]. The main cause of PKU is a wide range of mutations in the PAH gene [8]. About 1180 biallelic variants have been identified in the PAH gene [6]. In addition, the PAH gene has different polymorphic markers, such as intergenic short tandem repeats (STRs) located in intron 3, a variable number of tandem repeats located in the 3′ untranslated region (3′-UTR), and several restriction fragment length polymorphisms (RFLPs) that are strongly associated with the PAH region [9]. VNTR polymorphism has an AT-rich repeat unit and 30 base pairs, and several alleles of this polymorphism have been identified and reported worldwide [3]. Polymorphic markers that are strongly associated with the PAH gene facilitate prenatal diagnosis and identification of carriers [10]. So far, many studies have been conducted on PAH VNTR tandem repeat sequences. In these studies, the polymorphism of this sequence, its relationship with the types of PAH gene mutations, the ability of this sequence to identify PKU carriers, and the use of VNTR sequences along with STR repetitive sequences in forensic medicine have also been considered [10]. Among the conducted research, the study of Hosseini Mezinani et al. in 2008 reports 4 alleles of VNTR3, VNTR7, VNTR8, and VNTR9 repetitions in PKU chromosomes [3]. In another study conducted in 2017 by Razipour et al., 5 alleles of VNTR3, VNTR7, VNTR8, VNTR9, and VNTR12 repetitions were reported in Iranian PKU patients [9]. Also, in the study of Abedini and Khazaei in 2020, 5 alleles of VNTR3, VNTR7, VNTR8, VNTR9, and VNTR12 repetitions were identified in PKU patients in Northern Iran [10]. Polymorphic systems have a high degree of heterogeneity and are very informative for prenatal diagnosis and carrier screening in most populations [10]. According to the studies conducted in Iran, VNTR alleles in the Iranian population were 66% informative [3]. Considering the high prevalence of PKU and consanguineous marriages in the Iranian population, the current study was conducted to identify PAH VNTR alleles in PKU patients in Guilan Province, Iran.

Materials and Methods
Patients

This was descriptive cross-sectional research. The study population were 25 people with PKU, non-relatives from different areas of Guilan Province, who were referred to 17 Shahrivar Hospital in Rasht City, within a one-year period, and their disease was diagnosed by a pediatrician. The identification of these patients was based on the files available in 17 Shahrivar Hospital in Rasht City, Iran. Only one patient from each family was included in the study. The levels of phenylalanine pretreatment in 25 patients werre determined at 320-2453 µmol/L. Then, the patients and their families were invited to participate in this study. After explaining the aim of the study to the participants, the consent forms and questionnaires were completed by the subjects or their families (in cases where the patient was a child or mentally challenged). The study was approved by the ethics committee of Islamic Azad University, Rasht Branch. To collect blood samples from each patient, 2-5 mL of blood was collected, and to prevent blood coagulation, 15 mL falcons containing 300 µL of 0.5 M ethylenediaminetetraacetic acid were used as an anticoagulant.

DNA extraction
DynabioTM Blood/Tissue DNA Extraction Mini kit (Takapozist, Tehran, Iran) was used for DNA extraction. Fast extraction, yield, and a high degree of purity are the features of this kit. After extracting the DNA and before performing the PCR reaction to check the quantity and purity of the nucleic acid, the obtained DNA was checked with a nano-spectrophotometer (Thermo Scientific NanoDrop, 2000C, USA).

Polymerase chain reaction (PCR)
The PCR reaction was performed in Analytik Jena thermocycler (Germany). The sequence of of the forward and reverse primers used in this reaction was as follows [3]:
Forward primer: 5′-GCTTGAAACTTGAAAGTTGC-3′; 
Reverse primer: 5ꞌ-GGAAACTTAAGAATCCCCATC-3ꞌ.
Primers were synthesized by Bioneer Company, South Korea. The final volume of the PCR reaction mixture was 25 μL which was prepared using the AccuPower® PCR PreMix kit (Bioneer, South Korea) and adding genomic DNA, primer pair (20 pmol), and sterile water to the PreMix solution. The results of setting the PCR conditions for the amplification of the PAH VNTR fragment were as follows: Initial denaturation temperature of 94°C for 10 min, 30 reaction cycles, each cycle including denaturation temperature of 94°C for 1 min, primers binding temperature of 65°C for 1 min, extension temperature 72°C for 1 min and final extension temperature 72°C for 5 min.

Electrophoresis of PCR Products
To ensure the amplification of the desired fragment and its quality and not amplifying the non-specific products, 3 µL of reaction products (patient samples) and 100 base pairs marker (100 bp DNA Ladder, BR0800201, Biotechrabbit, Germany) on agarose gel 2% was loaded and electrophoresed (Figure 1 and Figure 2).

Sequencing
After observing the clear band of amplified fragments (PCR products) on 2% agarose gel, to ensure the presence of VNTR repeats, the PCR products were sequenced. Also, CLC main workbench software, version 3.5 was used to read the sequences and compare the sequencer device.
The statistical method used in the present study was descriptive; accordingly, the mean was used for the age variable of the patients, and the frequency distribution (percentage) was used for the VNTR alleles.

Results
Patients phenotype

In this study, out of 25 patients, 9(36%) were classified in the cPKU group, 8(32%) in the mPKU group, and 8(32%) in the mild HPA group. The pre-treatment Phe levels of 25 patients were determined at 320–2453 μmol/L. The rate of family marriage among patients’ parents was 52%. The mean age of the patients was 8.4 years (in the age range of 1 to 21 years) and their ethnic composition included 19 Gilak (76%), 3 Talesh (12%), and 3 Turks (12%).

The results of the nano-spectrophotometer
The spectrophotometer showed the amount of extracted DNA in the range of 100-500 ng/µL and the absorption ratio of 260/280 in the range of 1.8-2, that the extracted DNA with the mentioned quantity and purity was suitable for PCR.

Results of gel electrophoresis of PCR products
The electrophoresis image of PCR products on 2% agarose gel and the bands related to PAH VNTR fragments are shown in Figure 1A and Figure 1B. PCR products related to PAH VNTR alleles produced 380, 500, and 530 base pairs fragments, which corresponded to the presence of alleles of 3, 7, and 8 repetitions, respectively. Among the 50 investigated alleles, the alleles related to repetitions 3, 7, and 8 had frequencies of 6(12%), 6(12%), and 33(66%), respectively. Also, 5 alleles (10%) were indeterminate (ND). Table 1 shows the number and relative frequency of PAH VNTR alleles related to the studied patients.


Also, VNTR8/VNTR8, VNTR7/VNTR7, VNTR3/VNTR3, VNTR3/VNTR8, ND/VNTR8, and ND/ND genotypes were observed in the examined subjects, which have frequencies of 15(60%), 3(12%), 2(8%), 2(8%), 1(4%), and 2(8%), respectively.
Sequencing results After the PCR reaction, the PCR products were sequenced to confirm the number of VNTR repeats. The base sequence of PAH VNTR alleles was determined with CLC main workbench oftware, version 3.5. In this way, the number of VNTR repetitions was determined (Table 1). For example, sequencing the PCR product of patient number 11 confirmed that the VNTR allele of this patient has 7 repeats with a length of 30 nucleotides:

1- TGCACATATATGTATATGCATATGTACGTA
2- TGCACATATATGTATATGCATATGTACGTA
3- TGCACATATATGTATATGCATATGTACGTA
4- TGCACATATATGTATATGCATATGTACGTA
5- TGCACATATATGTATATGCATATGTACGTA
6- TGCACATATATGTATGTGCATATGTACGTA
7- TGCACATATATGTATGTGCATATGTATGTA

Discussion 
The VNTR alleles in the PAH gene were previously described by Eisensmith et al. [11] In this study, the VNTR alleles in the PAH gene were examined for the first time in 25 PKU patients in Guilan Province, Iran, and 3 VNTR alleles with 3, 7, and 8 repeats were identified with a frequency of 12%, 12%, and 66%. The highest frequency was related to VNTR8. Meanwhile, VNTR8 was observed in all 3 ethnic groups, namely Gilak, Talesh, and Turk, and the highest frequency was related to the Gilak ethnic group. Several studies have been conducted on VNTR alleles in the PAH gene in Iranian PKU families. In Valian Borojeni and Ebrahimi’s study, PAH VNTR alleles 3, 7, 8, and 9 repetitions were reported in PKU patients in Isfahan City, Iran [12].
 In the study by Hosseini-Mazinani et al., five VNTR alleles 3, 6, 7, 8, and 9 repetitions were identified in Iranian PKU families. The distribution of alleles in PKU chromosomes was as follows: VNTR3 (7.1%), VNTR6 (0%), VNTR7 (31.3%), VNTR8 (48.3%), and VNTR9 (13.3%). In this study, the highest frequency belonged to VNTR8 [3]. In the study of Parivar et al. in Yazd Province, Iran, 4 VNTR alleles with 3, 7, 8, and 12 repetitions were observed in PKU chromosomes with frequencies of 5.5%, 11%, 78%, and 5.5%, respectively. In their study, the highest frequency was related to the VNTR8 allele [13].
 In the study of Bagheri et al. in West Azerbaijan Province, Iran, VNTR8 (95%) and VNTR3 (5%) alleles were reported in 20 PKU patients [1]. In line with the above studies, in the present study, the highest frequency was related to VNTR8. In another study conducted by Bagheri et al. on Iranian Turkish-Azeri patients with PKU, 5 VNTR alleles, including VNTR3 (15.1%), VNTR7 (3.49%), VNTR8 (74.4%), VNTR9 (5.81%), and VNTR11 (1.16%) were identified, in which the 8-repeat allele was the most frequent [14]. In addition, in the study of Razipour et al., mutations and mini-haplotypes related to the PAH gene were investigated in 81 Iranian PKU patients. In their study, VNTR3, VNTR7, VNTR8, VNTR9, and VNTR12 alleles were observed [9]. Subsequently, in the study of Alibakshi et al., 18 unrelated PKU patients from 3 provinces of Kermanshah, Hamedan, and Lorestan in Iran were examined in terms of mutations and their relationship with VNTR alleles in the PAH gene. This study led to the identification of 11 specific mutations and 4 alleles of VNTR3, VNTR7, VNTR8, and VNTR9 [15].
 In another study conducted by Alibakshi et al. on PKU patients of Kurdish ethnicity in Kermanshah Province, Iran, VNTR alleles 3, 7, 8, and 9 were identified, and the most frequent allele was 8 [16]. Finally, in a study conducted in 2020 by Abedini and Khazaei for the first time on PKU patients from Golestan Province in Northern Iran, 26 unrelated PKU patients were examined in terms of PAH VNTR alleles, which led to the identification of 5 VNTR alleles: VNTR3 (28.85%), VNTR7 (28.85%), VNTR8 (17.3%), VNTR9 (19.23%), and VNTR12 (5.77%). In their study, in contrast to other studies conducted on the PKU population in different regions of Iran, 2 alleles of VNTR3 and VNTR7 had the highest frequency [10]. While in the present study, the highest frequency was assigned to VNTR8 from Guilan Province (another province located in the North of Iran).. This can be related to the different mutation spectrums in these populations. For example, the IVS10-11G>A mutation is the most common mutation causing PKU in Golestan Province [1718].
It is associated with VNTR7 (data not published), while the above mutation has shown a low frequency in PKU patients from Guilan Province, Iran [2]. In addition, based on the studies, it has been determined that the frequency of multiallelic VNTR in the PAH gene is significantly different among ethnic groups. Accordingly, different ethnic compositions in these two northern provinces of the country can be another reason for the difference in the frequency of VNTR alleles in these two populations. On the other hand, the frequency of the VNTR3 allele in PKU chromosomes in Guilan Province, Iran, was significantly different from the reports obtained from the European population. VNTR3 shows a lower frequency and VNTR8 shows a higher frequency compared to the European population [11] and this is partly related to different mutational spectrums in these populations. The R408W mutation is the most common mutation causing PKU in European populations, which is associated with the VNTR3 allele, especially in the eastern regions of this continent [3, 19]. This mutation is very rare in the Iranian population. According to the studies conducted in Iran regarding PAH VNTR alleles, in the current study in Guilan Province, Iran, VNTR alleles in the PAH gene have little variation, it is clear that markers with more alleles have a higher information rate. This study is the first reportregarding the genetic structure of PKU population using VNTR alleles in the PAH gene in Guilan Province. The limitations of the current research included the small sample size and the lack of sufficient funds to investigate another polymorphic marker called STR related to the PAH gene in PKU patients.

Conclusion 
Due to population diversity in Iran, the type of VNTR alleles in the PAH gene may be different in different regions. Therefore, it is necessary to investigate the frequency and distribution of VNTR marker alleles in different regions of the country. Overall, this study was a preliminary work for the future practical use of this sequence (VNTR) for various purposes, including the identification of heterozygous individuals for phenylketonuria in the community and the analysis of gene flow in the population.

Ethical Considerations
Compliance with ethical guidelines

This research has been approved by Islamic Azad University Rasht Branch (Code: REC.1397.138 IR.IAU.RASHT).

Funding
This research paper is taken from the master's thesis of Maryam Vakilpour, approved by Department of Genetics, Islamic Azad University-Tonekabon Branch (Code: 15930553962008|).

Authors' contributions
Writing and editing of the manuscript: Zeinab Khazaei Koohpar; Data collection and statistical analysis: Maryam Vakilpour.

Conflicts of interest
The authors declared no conflict of interest.

Acknowledgements
The authors of the article are grateful to Afshin Safai and the respected staff of 17 Shahrivar Hospital in Rasht, who helped the participants of this research.

References
  1. Bagheri M, Abdi Rad I, Hosseini Jazani N, Zarrin R, Ghazavi A. Association Between PAH Mutations and VNTR Alleles in the West Azerbaijani PKU Patients . MAEDICA: A Journal of Clinical Medicine. 2014; 9(3):242-7. [Link]
  2. Nemati H, Karimi Yousefi SS, Pourvatan N, Aparviz R, Farzaneh P, Khazaei Koohpar Z, et al. Mutation analysis of phenylketonuria in the north of Iran. Gene Reports. 2021; 24:101196. [DOI:10.1016/j.genrep.2021.101196]
  3. Hosseini-Mazinani SM, Koochmeshgi J, Khazaee-Koohpar Z, HoseinPur-Nobari N, Seifati SM. Carrier detection of phenylketonuria in Iranian families by variable number tandem-repeat polymorphism analysis. EMHJ-Eastern Mediterranean Health Journal. 2008; 14(6):1445-51. [Link]
  4. Jafarzadeh-Esfehani R, Vojdani S, Hashemian S, Mirinezhad M, Pourafshar M, Forouzanfar N, et al. Genetic variants of the phenylalanine hydroxylase gene in patients with phenylketonuria in the northeast of Iran. Journal of Pediatric Endocrinology & Metabolism. 2020; 33(3):355-9. [DOI:10.1515/jpem-2019-0351] [PMID]
  5. Gundorova P, Zinchenko RA, Makaov AK, Polyakov AV. The spectrum of mutations in the PAH gene in patients with hyperphenylalaninemia from the Karachay-Cherkess Republic. Russian Journal of Genetics. 2017; 53(7):813-9. [Link]
  6. Hillert A, Anikster Y, Belanger-Quintana A, Burlina A, Burton BK, Carducci C, et al. The genetic landscape and epidemiology of Phenylketonuria. American Journal of Human Genetics. 2020; 107(2):234-250. [DOI:10.1016/j.ajhg.2020.06.006] [PMID] [PMCID]
  7. Zarinkoob M, Khazaei Koohpar Z. Mutation analysis of exon 5 of PAH gene in phenylketonuria patients from Golestan Province, Iran. Journal of Shahrekord University of Medical Sciences. 2022; 24(1):15-9. [DOI:10.34172/jsums.2022.03]
  8. Rastegar Moghadam M, Shojaei A, Babaei V, Rohani F, Ghazi F. Mutation analysis of Phenylalanine hydroxylase gene in Iranian patients with Phenylketonuria. Medical Journal of The Islamic Republic of Iran. 2018; 32:21. [DOI:10.14196/mjiri.32.21] [PMID] [PMCID]
  9. Razipour M, Alavinejad E, Sajedi SZ, Talebi S, Entezam M, Mohajer N, et al. Genetic study of the PAH locus in the Iranian population: Familial gene mutations and minihaplotypes. Metabolic Brain Disease. 2017; 32(5):1685-91. [DOI:10.1007/s11011-017-0048-7] [PMID]
  10. Abedini G, Khazaei Koohpar Z. Identifying variable number of tandem repeat alleles in phenylalanine hydroxylase gene in patients with phenylketonuria in Golestan Province, Iran. Journal of Advances in Medical and Biomedical Research. 2020; 28(129):198-203. [Link]
  11. Eisensmith RC, Goltsov AA, Woo SL.A simple, rapid, and highly informative PCR-based procedure for prenatal diagnosis and carrier screening of phenylketonuria. Prenatal Diagnosis. 1994; 14 (12):1113-8. [DOI:10.1002/pd.1970141204]] [PMID]
  12. Valian Borojeni S, Ebrahimi E. Investigating the importance of PAH VNTR marker in the diagnosis of phenylketonuria disease carriers in Isfahan population. Genetics in the Third Millennium. 2009; 6(4):1477. [Link]
  13. Parivar K, Seifati SM, Koochmeshgi J. [Studying the level of informativity of VNTR marker on PAH gene for carrier detection of the patients with phenylketonuria in Yazd province, Iran (Persian)]. Medical Science Journal of Islamic Azad Univesity-Tehran Medical Branch. 2011; 21(3): 196-200. [Link]
  14. Bagheri M, Abdi Rad I, Hosseini Jazani N, Zarrin R, Ghazavi A. Frequency of the VNTR- Polymorphisms at the PAH gene in the Iranian Azeri Turkish Patients with phenylketonuria. MAEDICA - A Journal of Clinical Medicine.2015; 10(4):310-4. [Link]
  15. Alibakhshi R, Moradi K, Biglari M, Shafieenia S. Spectrum of phenylalanine hydroxylase gene mutations in Hamadan and Lorestan Provinces of Iran and their associations with variable number of tandem repeat alleles. Iranian Journal of Medical Sciences. 2018; 43(3):318-23. [Link]
  16. Alibakhshi R, Moradi K, Ghadiri K. The status of PAH gene-VNTR alleles and mini-haplotypes associations with PAH gene mutations in Iranian Kurdish PKU patients. Medical Journal of The Islamic Republic of Iran. 2019; 33:88 [DOI:10.47176/mjiri.33.88] [PMID] [PMCID]
  17. Zamanfar D, Jalali H, Mahdavi MR, Maadanisani M, Zaeri H, Asadpoor E. Investigation of five common mutations on phenylalanine hydroxylase gene of phenylketonuria patients from two provinces in North of Iran. International Journal of Preventive Medicine. 2017; 8:89. [PMID]
  18. Khazaei Koohpar Z, Qasemiyan Y, Haerian Ardakani H, Hashemi M, Kimiajou M, Mohammadian S, et al. Mutation spectrum of the phenylalanine hydroxylase gene in phenylketonuria patients in Golestan Province, Iran. Biology Bulletin. 2020; 47(6):569-75. [Link]
  19. Pronina N, Lugoveska R. Association between minihaplotypes and mutations at the phenylalanine hydroxylase locus in Latvian phenylketonuria patients PKU. Proceedings of The Latvian Academy of Sciences. 2011; 65(3-4):73-9. [DOI:10.2478/v10046-011-0021-5]

 
Type of Study: Original | Subject: Basic Medical Science
Received: 2022/08/14 | Accepted: 2022/09/23 | Published: 2022/09/23

Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.